ID: 1145963710_1145963716

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1145963710 1145963716
Species Human (GRCh38) Human (GRCh38)
Location 17:28902511-28902533 17:28902527-28902549
Sequence CCCCTTTGCTGGCTTCTCTGTGT TCTGTGTCCCGGCGGGTTCTCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 48, 4: 449} {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!