ID: 1145965093_1145965104

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1145965093 1145965104
Species Human (GRCh38) Human (GRCh38)
Location 17:28911343-28911365 17:28911393-28911415
Sequence CCCTTCTTGATTCTCAACCCATA GTGTGGTGAGGAAGGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195} {0: 1, 1: 0, 2: 6, 3: 62, 4: 731}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!