ID: 1145969050_1145969053

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1145969050 1145969053
Species Human (GRCh38) Human (GRCh38)
Location 17:28944480-28944502 17:28944502-28944524
Sequence CCTGAGTTAAAATTGAACATTAC CCGTATCTTCCATATTTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 176} {0: 1, 1: 0, 2: 0, 3: 7, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!