ID: 1145979668_1145979672

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1145979668 1145979672
Species Human (GRCh38) Human (GRCh38)
Location 17:29004296-29004318 17:29004311-29004333
Sequence CCCAAGATAGGTTCGGAATTCCT GAATTCCTAGGGACATCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52} {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!