ID: 1145982220_1145982239

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1145982220 1145982239
Species Human (GRCh38) Human (GRCh38)
Location 17:29019860-29019882 17:29019911-29019933
Sequence CCGCCTCAGTTCCCAGCTCCTGT CCAGGTGACCAGAAGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 42, 4: 494} {0: 1, 1: 1, 2: 0, 3: 59, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!