ID: 1145982222_1145982239

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1145982222 1145982239
Species Human (GRCh38) Human (GRCh38)
Location 17:29019871-29019893 17:29019911-29019933
Sequence CCCAGCTCCTGTCCCCCGCCACC CCAGGTGACCAGAAGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 526} {0: 1, 1: 1, 2: 0, 3: 59, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!