ID: 1145985431_1145985436

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1145985431 1145985436
Species Human (GRCh38) Human (GRCh38)
Location 17:29042880-29042902 17:29042902-29042924
Sequence CCTGAGACAAAGATCATAATGAG GACAGGAAGGTGGCAAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 211} {0: 1, 1: 1, 2: 7, 3: 82, 4: 799}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!