ID: 1145998763_1145998777

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1145998763 1145998777
Species Human (GRCh38) Human (GRCh38)
Location 17:29119093-29119115 17:29119126-29119148
Sequence CCTCCAATACAGCCAGGCCCCAG CAGGGAGTTCTTGATAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 281} {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!