ID: 1146012345_1146012352

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1146012345 1146012352
Species Human (GRCh38) Human (GRCh38)
Location 17:29206111-29206133 17:29206151-29206173
Sequence CCTCCGTCTCCTGGATTCAAGTG TCCCGAGTAGCTGGAATTACAGG
Strand - +
Off-target summary {0: 22, 1: 911, 2: 11248, 3: 45473, 4: 97361} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!