ID: 1146022545_1146022563

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1146022545 1146022563
Species Human (GRCh38) Human (GRCh38)
Location 17:29292691-29292713 17:29292726-29292748
Sequence CCCGCCCCGACTGCCCGCGCCTC GGAGCGGGAAACGCGGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 379} {0: 1, 1: 0, 2: 1, 3: 11, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!