ID: 1146022790_1146022807

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1146022790 1146022807
Species Human (GRCh38) Human (GRCh38)
Location 17:29293427-29293449 17:29293480-29293502
Sequence CCCCATCTCAGGGCCCCCAAATT TGGGAAAAGAATAATGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 224} {0: 1, 1: 0, 2: 4, 3: 39, 4: 502}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!