ID: 1146022799_1146022807

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1146022799 1146022807
Species Human (GRCh38) Human (GRCh38)
Location 17:29293443-29293465 17:29293480-29293502
Sequence CCAAATTGAGGTAACTCCAGGGA TGGGAAAAGAATAATGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 111} {0: 1, 1: 0, 2: 4, 3: 39, 4: 502}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!