ID: 1146034047_1146034066

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1146034047 1146034066
Species Human (GRCh38) Human (GRCh38)
Location 17:29390679-29390701 17:29390732-29390754
Sequence CCTCGGCTGTGTGAGGACTAGAG GCGGCGACGGAGACGGCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120} {0: 1, 1: 0, 2: 0, 3: 22, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!