ID: 1146052665_1146052673

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1146052665 1146052673
Species Human (GRCh38) Human (GRCh38)
Location 17:29566225-29566247 17:29566267-29566289
Sequence CCAGGTAGGACAGGAGCAGCGCC CCGCGAACAGCGGCGCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 191} {0: 1, 1: 0, 2: 1, 3: 3, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!