ID: 1146052774_1146052784

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1146052774 1146052784
Species Human (GRCh38) Human (GRCh38)
Location 17:29566658-29566680 17:29566699-29566721
Sequence CCCGGAGAACCAGGAGCGCGGGC AGCGCCGCAGGGCGCGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 185} {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!