ID: 1146053438_1146053449

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1146053438 1146053449
Species Human (GRCh38) Human (GRCh38)
Location 17:29569159-29569181 17:29569211-29569233
Sequence CCCTCCACAGTCACCATCTGAGG CCAACTTCTCCATCCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 412} {0: 1, 1: 0, 2: 3, 3: 31, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!