ID: 1146061691_1146061697

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1146061691 1146061697
Species Human (GRCh38) Human (GRCh38)
Location 17:29611236-29611258 17:29611268-29611290
Sequence CCTGAAGCAAACACACACACGCA CCCACAGTGCCTGCCGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 252, 4: 2447} {0: 1, 1: 0, 2: 0, 3: 29, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!