ID: 1146062760_1146062769

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1146062760 1146062769
Species Human (GRCh38) Human (GRCh38)
Location 17:29615686-29615708 17:29615708-29615730
Sequence CCGAGCTTGTGCGCCCCGCCCCG GCTCCGCCTGCCTGGCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 108} {0: 1, 1: 0, 2: 2, 3: 25, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!