ID: 1146078914_1146078922

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1146078914 1146078922
Species Human (GRCh38) Human (GRCh38)
Location 17:29759574-29759596 17:29759623-29759645
Sequence CCCCTTCTCCTTCAACCCCTAGC TGAATTTGACTTCTATAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 504} {0: 1, 1: 0, 2: 2, 3: 21, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!