ID: 1146082300_1146082302

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1146082300 1146082302
Species Human (GRCh38) Human (GRCh38)
Location 17:29791379-29791401 17:29791411-29791433
Sequence CCTGGCAAAAATAACAGATTATT TCTTCTTTGTTACCTGGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 456} {0: 1, 1: 0, 2: 2, 3: 18, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!