ID: 1146090689_1146090702

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1146090689 1146090702
Species Human (GRCh38) Human (GRCh38)
Location 17:29874399-29874421 17:29874439-29874461
Sequence CCCCACCCAGATCTCATCTTGAA CCGATAAGGGAGAGACCAGGTGG
Strand - +
Off-target summary {0: 184, 1: 7905, 2: 11315, 3: 9458, 4: 7160} {0: 1, 1: 0, 2: 1, 3: 56, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!