ID: 1146090693_1146090698

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1146090693 1146090698
Species Human (GRCh38) Human (GRCh38)
Location 17:29874405-29874427 17:29874436-29874458
Sequence CCAGATCTCATCTTGAATTGTAC ACCCCGATAAGGGAGAGACCAGG
Strand - +
Off-target summary {0: 19, 1: 726, 2: 7317, 3: 10689, 4: 10312} {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!