|
Left Crispr |
Right Crispr |
Crispr ID |
1146090693 |
1146090704 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:29874405-29874427
|
17:29874456-29874478
|
Sequence |
CCAGATCTCATCTTGAATTGTAC |
AGGTGGACTTAATTGAATCATGG |
Strand |
- |
+ |
Off-target summary |
{0: 19, 1: 726, 2: 7317, 3: 10689, 4: 10312} |
{0: 2, 1: 40, 2: 1227, 3: 2387, 4: 4672} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|