ID: 1146106198_1146106203

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1146106198 1146106203
Species Human (GRCh38) Human (GRCh38)
Location 17:30039543-30039565 17:30039567-30039589
Sequence CCCCTGCATCTTGCTTGTGGTGG GGTACCAAGATACCCCAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 219} {0: 1, 1: 1, 2: 1, 3: 8, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!