ID: 1146161297_1146161310

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1146161297 1146161310
Species Human (GRCh38) Human (GRCh38)
Location 17:30560571-30560593 17:30560624-30560646
Sequence CCCAGCCTGGAAGGGCCAGGTCC TCGGGCTCACCCCGTGCCTGTGG
Strand - +
Off-target summary {0: 5, 1: 4, 2: 17, 3: 33, 4: 313} {0: 2, 1: 0, 2: 16, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!