ID: 1146184699_1146184703 |
View in Genome Browser |
Spacer: -5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1146184699 | 1146184703 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 17:30717265-30717287 | 17:30717283-30717305 |
| Sequence | CCAGAAGCAGCCAGCACTTGGTG | TGGTGGAAGCTTCAGGTTTCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 0, 2: 2, 3: 18, 4: 191} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||