|
Left Crispr |
Right Crispr |
| Crispr ID |
1146208023 |
1146208029 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:30921828-30921850
|
17:30921849-30921871
|
| Sequence |
CCCGCGCGTCGGCGGAGCTCGGG |
GGGCCGGACTGGACCTGCCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 5, 4: 79} |
{0: 1, 1: 0, 2: 7, 3: 18, 4: 121} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|