ID: 1146208296_1146208308

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1146208296 1146208308
Species Human (GRCh38) Human (GRCh38)
Location 17:30922740-30922762 17:30922774-30922796
Sequence CCGGGCCCTGAACTGCCTCCAGG GGTCGCCGCGCAGCGGCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 67, 4: 469} {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!