ID: 1146242671_1146242676

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1146242671 1146242676
Species Human (GRCh38) Human (GRCh38)
Location 17:31244541-31244563 17:31244569-31244591
Sequence CCTTGAGCACCAGCTGAGCTCTG TGTTGCTTTCTGCTATGACAGGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 5, 3: 69, 4: 309} {0: 4, 1: 61, 2: 158, 3: 269, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!