ID: 1146272928_1146272939

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1146272928 1146272939
Species Human (GRCh38) Human (GRCh38)
Location 17:31496400-31496422 17:31496423-31496445
Sequence CCCCGTTCCATCTGGGTTAAGAG GGAAAATGAGGGCTGGGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49} {0: 1, 1: 0, 2: 7, 3: 70, 4: 610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!