ID: 1146315749_1146315765

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1146315749 1146315765
Species Human (GRCh38) Human (GRCh38)
Location 17:31805656-31805678 17:31805703-31805725
Sequence CCAAGTGAAGCAGCCCCAACCTA CTGGGGCATGGAAGGGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 116, 4: 1127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!