ID: 1146339609_1146339631

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1146339609 1146339631
Species Human (GRCh38) Human (GRCh38)
Location 17:32007676-32007698 17:32007723-32007745
Sequence CCGCCGCCGCCGCCGCCCACGTC CCGATACGCGGTAGTAGCCGGGG
Strand - +
Off-target summary {0: 3, 1: 4, 2: 89, 3: 1588, 4: 3355} {0: 1, 1: 0, 2: 0, 3: 1, 4: 4}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!