ID: 1146359022_1146359033

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1146359022 1146359033
Species Human (GRCh38) Human (GRCh38)
Location 17:32159320-32159342 17:32159349-32159371
Sequence CCGGGCCGAGTTACCCGTTGGCA CAGTGTGATCAGGCATGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49} {0: 1, 1: 2, 2: 4, 3: 23, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!