ID: 1146369305_1146369310

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1146369305 1146369310
Species Human (GRCh38) Human (GRCh38)
Location 17:32255164-32255186 17:32255190-32255212
Sequence CCAAGACAGACATCTTCCCTACT CAAAATCTCTAGTTTAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!