|
Left Crispr |
Right Crispr |
| Crispr ID |
1146416225 |
1146416238 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:32635640-32635662
|
17:32635684-32635706
|
| Sequence |
CCGAGATGGCGCCACTGCACTCC |
CTCCGTCTCGGGTGGCGGGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3752, 1: 45341, 2: 129347, 3: 154251, 4: 112760} |
{0: 1, 1: 2, 2: 5, 3: 32, 4: 190} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|