ID: 1146430068_1146430083

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1146430068 1146430083
Species Human (GRCh38) Human (GRCh38)
Location 17:32784802-32784824 17:32784840-32784862
Sequence CCCACAGAAAAGGAAGATACTGT ATGGAGAACCGGAAGGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 313} {0: 1, 1: 0, 2: 3, 3: 15, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!