ID: 1146438794_1146438806

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1146438794 1146438806
Species Human (GRCh38) Human (GRCh38)
Location 17:32876449-32876471 17:32876501-32876523
Sequence CCTCACCTGGCGCGGGGAAGCGC TAAACCCCGGACAGCGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 91} {0: 1, 1: 0, 2: 1, 3: 5, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!