ID: 1146438902_1146438918

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1146438902 1146438918
Species Human (GRCh38) Human (GRCh38)
Location 17:32876860-32876882 17:32876906-32876928
Sequence CCTGCTCCGCCATGGCGCCAGCG GGGCCTCCGGGGCCGCTCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 117} {0: 1, 1: 0, 2: 0, 3: 30, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!