ID: 1146448708_1146448716

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1146448708 1146448716
Species Human (GRCh38) Human (GRCh38)
Location 17:32954533-32954555 17:32954577-32954599
Sequence CCAGTTTGCTGAAAGACAGACCT GATACATCTCTCTTTGGGAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!