ID: 1146467153_1146467158

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1146467153 1146467158
Species Human (GRCh38) Human (GRCh38)
Location 17:33095381-33095403 17:33095396-33095418
Sequence CCCTCTCTGTTAAGACTGAGAGA CTGAGAGATCTCTTGGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 203} {0: 1, 1: 0, 2: 2, 3: 14, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!