ID: 1146467323_1146467326

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1146467323 1146467326
Species Human (GRCh38) Human (GRCh38)
Location 17:33096554-33096576 17:33096577-33096599
Sequence CCAGCACAGTGAAGCCAACAGCA TGGTGAAGTCTCTGTCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 300} {0: 1, 1: 0, 2: 0, 3: 30, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!