ID: 1146467323_1146467333

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1146467323 1146467333
Species Human (GRCh38) Human (GRCh38)
Location 17:33096554-33096576 17:33096600-33096622
Sequence CCAGCACAGTGAAGCCAACAGCA AGCTCATGTTCTGATGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 300} {0: 1, 1: 0, 2: 4, 3: 50, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!