ID: 1146471942_1146471951

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1146471942 1146471951
Species Human (GRCh38) Human (GRCh38)
Location 17:33131709-33131731 17:33131752-33131774
Sequence CCTGTCCTCTCCAAGAGGACCAT CAGAGGCCTCTTCATTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134} {0: 1, 1: 0, 2: 2, 3: 39, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!