ID: 1146479850_1146479852

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1146479850 1146479852
Species Human (GRCh38) Human (GRCh38)
Location 17:33196481-33196503 17:33196508-33196530
Sequence CCAGACAGGAAGGTGTAGCCAGC GAGCATACATAGAATTACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179} {0: 1, 1: 0, 2: 0, 3: 13, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!