ID: 1146482173_1146482176

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1146482173 1146482176
Species Human (GRCh38) Human (GRCh38)
Location 17:33213586-33213608 17:33213635-33213657
Sequence CCTGTTACCATCGTCCTGCGGTC TAGCTTTCTGATCTGCCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31} {0: 1, 1: 0, 2: 2, 3: 17, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!