ID: 1146482922_1146482932

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1146482922 1146482932
Species Human (GRCh38) Human (GRCh38)
Location 17:33219597-33219619 17:33219627-33219649
Sequence CCCGTAGTCTTAAGCCCCTGCAT ACTGTGTCCTGCGGGACTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 70} {0: 1, 1: 0, 2: 0, 3: 19, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!