ID: 1146484469_1146484474

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1146484469 1146484474
Species Human (GRCh38) Human (GRCh38)
Location 17:33231829-33231851 17:33231853-33231875
Sequence CCAGCAAAACAATGTTTGCTCAA ATTGAGATGAGCAATGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 248} {0: 1, 1: 0, 2: 2, 3: 29, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!