ID: 1146497554_1146497558

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1146497554 1146497558
Species Human (GRCh38) Human (GRCh38)
Location 17:33336617-33336639 17:33336658-33336680
Sequence CCACAGGTGAAAATAGTGAAGTT TGCTCAAGGCTGCCTGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193} {0: 1, 1: 0, 2: 2, 3: 21, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!