ID: 1146511762_1146511768

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1146511762 1146511768
Species Human (GRCh38) Human (GRCh38)
Location 17:33455713-33455735 17:33455763-33455785
Sequence CCAAAGGCTAAAGAACAGTGAAA CTCAAAAGCCCCAGATAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 280} {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!