ID: 1146530496_1146530501

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1146530496 1146530501
Species Human (GRCh38) Human (GRCh38)
Location 17:33604050-33604072 17:33604089-33604111
Sequence CCTAGAAAATGTAGTCTAGTTAT CTGCAGGCTGAAAGGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 249} {0: 1, 1: 0, 2: 9, 3: 52, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!